Stem-loop sequence csi-MIR396d

AccessionMI0039665 (change log)
DescriptionCitrus sinensis miR396d stem-loop
Literature search

1 open access papers mention csi-MIR396d
(1 sentences)

Stem-loop
   -----caucga    a  --       cagcca gg      c              uuccuucuucuucuucucuaauuauagg 
5'            aagc cc  guuugcc      u  ccacag uuucuugaacuucu                            c
              |||| ||  |||||||      |  |||||| ||||||||||||||                            u
3'            uucg gg  uaaacgg      a  gguguc aaagaacuugaaga                            a
   uuccucuuuaa    -  aa       -uaaag ag      u              cuaucgacgucgaucgguguaguuuauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr9: 4490369-4490532 [+]
intergenic
Database links

Mature sequence csi-miR396d-3p

Accession MIMAT0048927
Sequence

115 - 

uucaagaaaucugugggaag

 - 134

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).