Stem-loop sequence csi-MIR395c

AccessionMI0039664 (change log)
DescriptionCitrus sinensis miR395c stem-loop
Literature search

4 open access papers mention csi-MIR395c
(26 sentences)

Stem-loop
   aa  g    --aa  -     u    uc ug                    u      cauuca  ga 
5'   ga gcaa    ga gucag uggu  c  gaguuccuccgagcacuuca uggggu      ga  a
     || ||||    || ||||| ||||  |  |||||||||||||||||||| ||||||      ||   
3'   cu uguu    uu caguc accg  g  cucaaggggguuugugaagu auccca      cu  a
   -c  a    gaca  a     c    uu gu                    c      ---cug  ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr5: 25604742-25604872 [-]
intergenic
Database links

Mature sequence csi-miR395c-3p

Accession MIMAT0048926
Sequence

81 - 

cugaaguguuugggggaacuc

 - 101

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).