Stem-loop sequence csi-MIR395b

AccessionMI0039663 (change log)
DescriptionCitrus sinensis miR395b stem-loop
Literature search

4 open access papers mention csi-MIR395b
(26 sentences)

Stem-loop
   ugacu  a    -----c        u c  ua         ug         u     acuc 
5'      gc caug      aucaggug c cc  gaguucccc  aacacuuca ugggg    c
        || ||||      |||||||| | ||  |||||||||  ||||||||| |||||    u
3'      cg guac      uaguuuac g gg  cucaagggg  uugugaagu auccc    u
   ---ug  a    ucauua        u a  uc         gu         c     aauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr7: 2081126-2081246 [-]
intergenic
Database links

Mature sequence csi-miR395b-5p

Accession MIMAT0048924
Sequence

31 - 

guuccccugaacacuucauug

 - 51

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR395b-3p

Accession MIMAT0048925
Sequence

71 - 

cugaaguguuugggggaacuc

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).