Stem-loop sequence csi-MIR394b

AccessionMI0039662 (change log)
DescriptionCitrus sinensis miR394b stem-loop
Literature search

4 open access papers mention csi-MIR394b
(11 sentences)

Stem-loop
   -       auuuu     u   u         uuaau   uuuc    uu c 
5'  cagaguc     ggcau cug ccaccuccg     ucu    uuuu  g c
    |||||||     ||||| ||| |||||||||     |||    ||||  |  
3'  gucucgg     ccgua gau gguggaggu     aga    aaag  c c
   u       acaau     c   c         ---uu   uucu    uu a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
JH999157.1: 292152-292253 [-]
intergenic
Database links

Mature sequence csi-miR394b-5p

Accession MIMAT0048923
Sequence

11 - 

uuggcauucuguccaccucc

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).