Stem-loop sequence csi-MIR393c

AccessionMI0039661 (change log)
DescriptionCitrus sinensis miR393c stem-loop
Literature search

2 open access papers mention csi-MIR393c
(9 sentences)

Stem-loop
   ----    ucuugcuucu  a  ua     ua             c    u      ---a   c    u   aa 
5'     gguu          gc ac  gagga  aauccaaagggau gcau gauccu    agc uuaa uau  u
       ||||          || ||  |||||  ||||||||||||| |||| ||||||    ||| |||| |||  u
3'     cuaa          cg ug  uuccu  uuagguuucccua cgua cuagga    uug aauu aua  c
   aucu    --uauauacu  a  gc     cc             u    -      guac   u    c   cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr7: 31959511-31959653 [+]
intergenic
Database links

Mature sequence csi-miR393c-5p

Accession MIMAT0048921
Sequence

31 - 

uccaaagggaucgcauugauc

 - 51

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR393c-3p

Accession MIMAT0048922
Sequence

93 - 

aucaugcuaucccuuuggauu

 - 113

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).