Stem-loop sequence csi-MIR393b

AccessionMI0039660 (change log)
DescriptionCitrus sinensis miR393b stem-loop
Literature search

2 open access papers mention csi-MIR393b
(9 sentences)

Stem-loop
   ugagaguucuuga    u  ---      a       a            u       ugauaacauuaaauuaaucacucaaacggg 
5'              uuag gc   aggugg gaguucc aagggaucgcau gaucuga                              u
                |||| ||   |||||| ||||||| |||||||||||| |||||||                              u
3'              aauc cg   ucuacc cuuaagg uucccuagcgua cuagauu                              g
   -uauauauuuuua    u  gua      c       c            -       uuuacuuucuuuaguauauauauuauuuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr9: 16703306-16703479 [-]
intergenic
Database links

Mature sequence csi-miR393b-5p

Accession MIMAT0048919
Sequence

31 - 

uuccaaagggaucgcauugauc

 - 52

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR393b-3p

Accession MIMAT0048920
Sequence

124 - 

ucaugcgaucccuucggaauu

 - 144

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).