Stem-loop sequence csi-MIR390b

AccessionMI0039659 (change log)
DescriptionCitrus sinensis miR390b stem-loop
Literature search

2 open access papers mention csi-MIR390b
(10 sentences)

Stem-loop
   --auuucguuuguca    u          u           g           ugauaauauucuuuuuuaauuaauu 
5'                agua ggagaaucug aaagcucagga ggauagcgcca                         a
                  |||| |||||||||| ||||||||||| |||||||||||                         a
3'                ucgu cuucuuaggc uuuugaguccu ucuaucgcggu                         u
   uugacgugguuuuga    u          c           a           cgcggcgauuaacuaguuccuuaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr8: 22527260-22527418 [+]
intergenic
Database links

Mature sequence csi-miR390b-5p

Accession MIMAT0048918
Sequence

32 - 

agcucaggagggauagcgcc

 - 51

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).