Stem-loop sequence csi-MIR172d

AccessionMI0039658 (change log)
DescriptionCitrus sinensis miR172d stem-loop
Literature search

5 open access papers mention csi-MIR172d
(15 sentences)

Stem-loop
   --aagagcuagcugcug c         ggu                   a  agcuuuagcaagggaauucauugaau 
5'                  c aauauuugc   ugcggcaucaucaagauuc ca                          a
                    | |||||||||   ||||||||||||||||||| ||                          g
3'                  g uuauaaacg   acgucguaguaguucuaag gu                          g
   caccauacuuagcauca u         acu                   g  aauaaaccuuccuugaaaacuuaucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr8: 21300353-21300511 [+]
intergenic
Database links

Mature sequence csi-miR172d-5p

Accession MIMAT0048917
Sequence

31 - 

gcggcaucaucaagauucaca

 - 51

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).