Stem-loop sequence csi-MIR172b

AccessionMI0039657 (change log)
DescriptionCitrus sinensis miR172b stem-loop
Literature search

5 open access papers mention csi-MIR172b
(15 sentences)

Stem-loop
   ---------     gaacaaac      cgu    a                     a    uauauauauauauauauauauauauauagauauagauaua 
5'          augau        agucau   uugc gaugcagcaucaucaagauuc caug                                        u
            |||||        ||||||   |||| ||||||||||||||||||||| ||||                                        g
3'          uacua        ucagua   agcg cuacgucguaguaguucuaag guac                                        c
   aucuauaua     -------a      aau    a                     a    uuccguuauuucguuuuucuauuuguagaaaggugguaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr7: 24627515-24627705 [+]
intergenic
Database links

Mature sequence csi-miR172b-5p

Accession MIMAT0048915
Sequence

31 - 

gcagcaucaucaagauucaca

 - 51

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR172b-3p

Accession MIMAT0048916
Sequence

141 - 

agaaucuugaugaugcugcau

 - 161

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).