Stem-loop sequence csi-MIR171i

AccessionMI0039656 (change log)
DescriptionCitrus sinensis miR171i stem-loop
Literature search

3 open access papers mention csi-MIR171i
(3 sentences)

Stem-loop
   aaa    ---   a        ug          ugag     u    aaaga 
5'    gcau   acg gauauugg  cgguucaauc    agcag gcuc     c
      ||||   ||| ||||||||  ||||||||||    ||||| ||||      
3'    cgug   ugc cuauaacc  gccgaguuag    uuguc cgag     u
   --a    cac   a        gu          uuua     c    aagaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 1312646-1312748 [+]
intergenic
Database links

Mature sequence csi-miR171i-3p

Accession MIMAT0048914
Sequence

71 - 

ugauugagccgugccaauauc

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).