Stem-loop sequence csi-MIR171h

AccessionMI0039655 (change log)
DescriptionCitrus sinensis miR171h stem-loop
Literature search

4 open access papers mention csi-MIR171h
(4 sentences)

Stem-loop
   g    a  guu           ua        c  uc   auu     u 
5'  gagu aa   ugauguuggca  gcucaauc ga  aaa   cucag g
    |||| ||   |||||||||||  |||||||| ||  |||   ||||| c
3'  cuua uu   acuauaaccgu  cgaguuag cu  uuu   gaguc a
   -    c  -ac           gc        u  ua   ccu     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 24735623-24735721 [+]
intergenic
Database links

Mature sequence csi-miR171h-3p

Accession MIMAT0048913
Sequence

69 - 

ugauugagccgugccaauauc

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).