Stem-loop sequence csi-MIR171f

AccessionMI0039653 (change log)
DescriptionCitrus sinensis miR171f stem-loop
Literature search

3 open access papers mention csi-MIR171f
(3 sentences)

Stem-loop
      u  ---auauau         u   c u         c       c      ----------     -  uuua        u 
5' gug gu         augaaaggg agc g gauauuggc ugguuca ucagac          aaacc gg    uuugcuuu a
   ||| ||         ||||||||| ||| | ||||||||| ||||||| ||||||          ||||| ||    ||||||||  
3' cac ca         uacuuucuc uug c cuauaaccg gccgagu aguuug          uuugg cc    aaacgaga u
      u  gaaccuuuu         u   - u         u       u      guuuuguuuu     a  -uug        u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr1: 28277765-28277922 [+]
intergenic
Database links

Mature sequence csi-miR171f-5p

Accession MIMAT0048910
Sequence

31 - 

uauuggccugguucacucaga

 - 51

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR171f-3p

Accession MIMAT0048911
Sequence

108 - 

ugauugagccgugccaauauc

 - 128

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).