Stem-loop sequence csi-MIR171e

AccessionMI0039652 (change log)
DescriptionCitrus sinensis miR171e stem-loop
Literature search

3 open access papers mention csi-MIR171e
(3 sentences)

Stem-loop
   ----ga                    aaucauca             c      uu   g          gugg 
5'       aggggagaguuguaaaauga        agguauuggcgcg cucaau  aaa acgugguuaa    g
         ||||||||||||||||||||        ||||||||||||| ||||||  ||| ||||||||||     
3'       uccucucucaauguuuuauu        ucuauaacugcgc gaguua  uuu uguaccgauu    c
   uauauc                    --aauucc             c      cu   a          agua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 18268665-18268808 [+]
intergenic
Database links

Mature sequence csi-miR171e-3p

Accession MIMAT0048909
Sequence

94 - 

uugagccgcgucaauaucucc

 - 114

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).