Stem-loop sequence csi-MIR171d

AccessionMI0039651 (change log)
DescriptionCitrus sinensis miR171d stem-loop
Literature search

3 open access papers mention csi-MIR171d
(3 sentences)

Stem-loop
   aga      ---auac    a   u     c         c       u      -  -----         a 
5'    gcugca       ugaa uag cacug gauauuggc cgguuca ucagag cu     uaagcguuu a
      ||||||       |||| ||| ||||| ||||||||| ||||||| |||||| ||     ||||||||| g
3'    cgacgu       acuu auu gugau cuauaaccg gccgagu aguuuc gg     guucguaag c
   -cc      accacaa    c   c     u         u       u      a  ugguc         u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr3: 27933094-27933232 [-]
intergenic
Database links

Mature sequence csi-miR171d-3p

Accession MIMAT0048908
Sequence

89 - 

ugauugagccgugccaauauc

 - 109

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).