Stem-loop sequence csi-MIR171c

AccessionMI0039650 (change log)
DescriptionCitrus sinensis miR171c stem-loop
Literature search

3 open access papers mention csi-MIR171c
(3 sentences)

Stem-loop
   --agc   -     -uu   auuuaaaac           a               c   uau    --  a 
5'      ggu aagug   gaa         ggagauguugg acggcucaaucaaau aaa   ccua  ug a
        ||| |||||   |||         ||||||||||| ||||||||||||||| |||   ||||  ||  
3'      cua uucgc   cuu         ccucuauaacc ugccgaguuaguuua uuu   gggu  ac a
   uucaa   c     uuu   --cugcucu           g               a   ccu    ua  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
JH999147.1: 178217-178354 [+]
intergenic
Database links

Mature sequence csi-miR171c-5p

Accession MIMAT0048906
Sequence

31 - 

uguuggaacggcucaaucaaa

 - 51

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR171c-3p

Accession MIMAT0048907
Sequence

88 - 

ugauugagccgugccaauauc

 - 108

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).