Stem-loop sequence csi-MIR169n

AccessionMI0039649 (change log)
DescriptionCitrus sinensis miR169n stem-loop
Literature search

5 open access papers mention csi-MIR169n
(12 sentences)

Stem-loop
   -----gac c        au          a  ugu   uac 
5'         g agccaagg  gacuugccgg ga   uug   a
           | ||||||||  |||||||||| ||   |||    
3'         c ucgguucc  uugaacggcc cu   aac   u
   uccgguua a        cg          -  -uu   uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr7: 4557016-4557094 [-]
intergenic
Clustered miRNAs
< 10kb from csi-MIR169n
csi-MIR169ochr7: 4557214-4557309 [-]
csi-MIR169nchr7: 4557016-4557094 [-]
Database links

Mature sequence csi-miR169n-5p

Accession MIMAT0048904
Sequence

5 - 

cagccaaggaugacuugccgg

 - 25

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR169n-3p

Accession MIMAT0048905
Sequence

52 - 

ggcaaguugcccuuggcuaca

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).