Stem-loop sequence csi-MIR169m

AccessionMI0039648 (change log)
DescriptionCitrus sinensis miR169m stem-loop
Literature search

5 open access papers mention csi-MIR169m
(12 sentences)

Stem-loop
   ------u      a  c     uauau  u      c         ug          agaaugcuguguuuccagcucuccuuggauauguu 
5'        gcgugc gg gcaga     ag agcgug agccaagga  acuugccggc                                   c
          |||||| || |||||     || |||||| |||||||||  ||||||||||                                    
3'        cguaug cc cgucu     uc uuguac ucgguuccu  ugaacgguug                                   a
   uccggac      -  u     ----u  u      a         gu          aacgugguuaaguaaguaauguuauauauacaaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr9: 1732704-1732880 [+]
intergenic
Database links

Mature sequence csi-miR169m-5p

Accession MIMAT0048903
Sequence

31 - 

cagccaaggaugacuugccgg

 - 51

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).