Stem-loop sequence csi-MIR169l

AccessionMI0039647 (change log)
DescriptionCitrus sinensis miR169l stem-loop
Literature search

5 open access papers mention csi-MIR169l
(12 sentences)

Stem-loop
   --u   a      -   a    u   a   u   -         u    u     -au   u  ua  u    -------    a 
5'    cua caugaa gaa agag gcu guu ggu agccaagga gacu gccug   cuc cc  ag gguu       ucaa a
      ||| |||||| ||| |||| ||| ||| ||| ||||||||| |||| |||||   ||| ||  || ||||       ||||  
3'    gau guacuu cuu ucuc cga cag uca ucgguuccu cuga cggac   ggg gg  uc ccaa       aguu c
   ccc   g      u   c    -   -   u   a         -    -     cau   u  gc  -    auuuaua    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 10938344-10938498 [+]
intergenic
Database links

Mature sequence csi-miR169l-5p

Accession MIMAT0048901
Sequence

31 - 

uagccaaggaugacuugccu

 - 50

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR169l-3p

Accession MIMAT0048902
Sequence

106 - 

aggcagucuccuuggcuaac

 - 125

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).