Stem-loop sequence csi-MIR169k

AccessionMI0039646 (change log)
DescriptionCitrus sinensis miR169k stem-loop
Literature search

5 open access papers mention csi-MIR169k
(12 sentences)

Stem-loop
   ag    u     u     u ag    u   g  c     ag             caacauuggcauguugaucacuucauuuuugcuucau 
5'   gucu gcaug gggaa g  ggua gug ug agcca  gaugacuugccgg                                     u
     |||| ||||| ||||| |  |||| ||| || |||||  |||||||||||||                                      
3'   uagg cguac cucuu c  ccgu cau ac ucggu  cuacugaacggcu                                     a
   ua    u     u     - cu    -   a  a     cu             acuugaucaauuguguaaauacaucaccacaguauag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr6: 20609191-20609372 [+]
intergenic
Database links

Mature sequence csi-miR169k-5p

Accession MIMAT0048900
Sequence

34 - 

cagccaaggaugacuugccgg

 - 54

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).