Stem-loop sequence csi-MIR169j

AccessionMI0039645 (change log)
DescriptionCitrus sinensis miR169j stem-loop
Literature search

5 open access papers mention csi-MIR169j
(12 sentences)

Stem-loop
   --uucuua      -  u     uaac   -u            u     g    -    ugu   uau  uu        a 
5'         caugaa ga aagag    guu  guuagccaagga gacuu ccug cggc   caa   ca  agguuuca g
           |||||| || |||||    |||  |||||||||||| ||||| |||| ||||   |||   ||  ||||||||  
3'         guacuu cu uucuc    cag  uaaucgguuccu cugag ggac gcug   guu   gu  uccgaagu c
   uccaaaac      u  u     -cga   uc            -     -    c    ---   --u  uu        a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 27132069-27132221 [+]
intergenic
Database links

Mature sequence csi-miR169j-5p

Accession MIMAT0048899
Sequence

31 - 

uagccaaggaugacuugccu

 - 50

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).