Stem-loop sequence csi-MIR169i

AccessionMI0039644 (change log)
DescriptionCitrus sinensis miR169i stem-loop
Literature search

5 open access papers mention csi-MIR169i
(13 sentences)

Stem-loop
   ---------------------ucuaguuugg         a     u     auucu    a    gc       -----------        a 
5'                                uagccaagg ugacu gccug     ucca uuaa  gguuuca           gauuaauc u
                                  ||||||||| ||||| |||||     |||| ||||  |||||||           |||||||| a
3'                                aucgguucc acuga cggac     gggu aguu  ccgaagu           uuaauuag u
   cggaucguacucucuguucucugacaguuca         -     -     -cauu    -    -a       aaauuuuuuga        u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 11046938-11047093 [+]
intergenic
Clustered miRNAs
< 10kb from csi-MIR169i
csi-MIR169ichr2: 11046938-11047093 [+]
csi-MIR169dchr2: 11047192-11047344 [+]
csi-MIR169echr2: 11051619-11051777 [+]
Database links

Mature sequence csi-miR169i-5p

Accession MIMAT0048898
Sequence

11 - 

uagccaaggaugacuugccu

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).