Stem-loop sequence csi-MIR169h

AccessionMI0039643 (change log)
DescriptionCitrus sinensis miR169h stem-loop
Literature search

5 open access papers mention csi-MIR169h
(12 sentences)

Stem-loop
   ----    u       -u    u   a     u   -         u    u     c  cuugauu      c    g     ag 
5'     gucu gcaugaa  auaa agc uuguu gcu agccaagga gacu gccug gc       gcaaga gagg uuuca  u
       |||| |||||||  |||| ||| ||||| ||| ||||||||| |||| ||||| ||       |||||| |||| |||||   
3'     cgga cguacuu  uauu ucg gacag cga ucgguuccu cugg cggac cg       uguucu cucc aaggu  g
   cuuc    u       uc    c   -     u   a         -    -     -  -uugguu      -    g     cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 11006174-11006335 [+]
intergenic
Database links

Mature sequence csi-miR169h-5p

Accession MIMAT0048897
Sequence

31 - 

uagccaaggaugacuugccu

 - 50

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).