Stem-loop sequence csi-MIR169g

AccessionMI0039642 (change log)
DescriptionCitrus sinensis miR169g stem-loop
Literature search

5 open access papers mention csi-MIR169g
(12 sentences)

Stem-loop
   ---   u         g    aaugau c    c         ug        gcaagccccuuuccuagaaccuaagcaucauauuuuuagauggcuucacaa 
5'    ucu gcaugugga auga      g ggug agccaagga  acuugccg                                                   u
      ||| ||||||||| ||||      | |||| |||||||||  ||||||||                                                   u
3'    aga uguacacuu uacu      c ccac ucgguuucu  ugaacggc                                                   a
   ucc   u         g    --ccgu u    a         gu        uaauugggauguucacuucgauauuuuaguuugggguucaguuuucugagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr7: 1615803-1616008 [-]
intergenic
Database links

Mature sequence csi-miR169g-5p

Accession MIMAT0048896
Sequence

31 - 

cagccaaggaugacuugccgg

 - 51

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).