Stem-loop sequence csi-MIR169f

AccessionMI0039641 (change log)
DescriptionCitrus sinensis miR169f stem-loop
Literature search

5 open access papers mention csi-MIR169f
(12 sentences)

Stem-loop
   -agc   a      --ga    a   u   -u                        cuuuuaaagaaaggucucucaacuuuagcuua 
5'     cua caugaa    aaga ccu guu  gauagccaaggaugacuugccuug                                g
       ||| ||||||    |||| ||| |||  ||||||||||||||||||||||||                                 
3'     gau guacuu    uucu gga cag  uuaucgguuucugcugaacggaac                                c
   uuca   c      auua    c   -   uu                        cuuggacguguuccuaugaucgauauauacau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr6: 14255727-14255899 [-]
intergenic
Database links

Mature sequence csi-miR169f-5p

Accession MIMAT0048895
Sequence

31 - 

uagccaaggaugacuugccu

 - 50

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).