Stem-loop sequence csi-MIR169e

AccessionMI0039640 (change log)
DescriptionCitrus sinensis miR169e stem-loop
Literature search

5 open access papers mention csi-MIR169e
(12 sentences)

Stem-loop
   --    ua      -u    uauca    uug           u    u     -  -  uugauu      c    g     ag 
5'   gucu  caugaa  auaa     uugu   uuagccaagga gacu gccug ca cc      gcaaga gagg uuuca  u
     ||||  ||||||  ||||     ||||   ||||||||||| |||| ||||| || ||      |||||| |||| |||||   
3'   cgga  guacuu  uauu     gaca   aaucgguuccu cuga cggac gu gg      uguucu cucc aaggu  g
   uc    uc      uc    -cucg    cug           -    -     c  u  ----uu      -    g     cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 11051619-11051777 [+]
intergenic
Clustered miRNAs
< 10kb from csi-MIR169e
csi-MIR169ichr2: 11046938-11047093 [+]
csi-MIR169dchr2: 11047192-11047344 [+]
csi-MIR169echr2: 11051619-11051777 [+]
Database links

Mature sequence csi-miR169e-5p

Accession MIMAT0048893
Sequence

31 - 

uagccaaggaugacuugccu

 - 50

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR169e-3p

Accession MIMAT0048894
Sequence

109 - 

caggcagucuccuuggcuaag

 - 129

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).