Stem-loop sequence csi-MIR169d

AccessionMI0039639 (change log)
DescriptionCitrus sinensis miR169d stem-loop
Literature search

5 open access papers mention csi-MIR169d
(12 sentences)

Stem-loop
   -gucuu       -  u    -  aa  uuug           u    u     -     -u    uauaauu        a 
5'       gcaugaa ga aaga gu  uu    uuagccaagga gacu gccug cggcu  gcaa       agguuuca g
         ||||||| || |||| ||  ||    ||||||||||| |||| ||||| |||||  ||||       |||||||| c
3'       cguacuu cu uucu cg  ag    aaucgguuccu cuga cggac guugg  uguu       uccgaagu u
   ccaaau       u  c    u  ac  -ucg           -    -     c     uu    ------u        u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 11047192-11047344 [+]
intergenic
Clustered miRNAs
< 10kb from csi-MIR169d
csi-MIR169ichr2: 11046938-11047093 [+]
csi-MIR169dchr2: 11047192-11047344 [+]
csi-MIR169echr2: 11051619-11051777 [+]
Database links

Mature sequence csi-miR169d-5p

Accession MIMAT0048891
Sequence

31 - 

uagccaaggaugacuugccu

 - 50

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR169d-3p

Accession MIMAT0048892
Sequence

103 - 

caggcagucuccuuggcuaag

 - 123

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).