Stem-loop sequence csi-MIR169c

AccessionMI0039638 (change log)
DescriptionCitrus sinensis miR169c stem-loop
Literature search

5 open access papers mention csi-MIR169c
(13 sentences)

Stem-loop
   -    ua      -        aaa    u   -         u    u     -  u -au   --    gg    gagu 
5'  gccu  caugaa gagaggag   uguu guu agccaagga gacu gccug cg c   gca  agag  uuuc    a
    ||||  |||||| ||||||||   |||| ||| ||||||||| |||| ||||| || |   |||  ||||  ||||    g
3'  cgga  guacuu cucuucuc   acag cga ucgguuccu cuga cggac gu g   ugu  ucuc  aaag    c
   c    uc      u        -cg    u   a         -    -     c  u guu   ca    ga    auau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 10985954-10986108 [+]
intergenic
Clustered miRNAs
< 10kb from csi-MIR169c
csi-MIR169pchr2: 10984178-10984294 [+]
csi-MIR169cchr2: 10985954-10986108 [+]
Database links

Mature sequence csi-miR169c-5p

Accession MIMAT0048889
Sequence

31 - 

uagccaaggaugacuugccu

 - 50

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR169c-3p

Accession MIMAT0048890
Sequence

105 - 

caggcagucuccuuggcuaag

 - 125

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).