Stem-loop sequence csi-MIR169b

AccessionMI0039637 (change log)
DescriptionCitrus sinensis miR169b stem-loop
Literature search

5 open access papers mention csi-MIR169b
(12 sentences)

Stem-loop
   uc         -         u  cuu     -     c     c     ucu   uua   a      c  aaaauauacgaguuaauuaacauaaaaucaga 
5'   ucguuuugu agccaagga ga   gccug gagcc cucaa gguau   uac   uuu ucauuu uc                                u
     ||||||||| ||||||||| ||   ||||| ||||| ||||| |||||   |||   ||| |||||| ||                                c
3'   gguagaacg ucgguuccu cu   cggac uuugg gaguu cuaug   aug   gga aguaaa ag                                a
   uc         a         -  -ac     g     u     u     ---   uca   a      -  aacuucaucuuacauucgugaugagaugaagc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr7: 1152858-1153060 [-]
intergenic
Database links

Mature sequence csi-miR169b-5p

Accession MIMAT0048888
Sequence

11 - 

uagccaaggaugacuugccu

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).