Stem-loop sequence csi-MIR167e

AccessionMI0039636 (change log)
DescriptionCitrus sinensis miR167e stem-loop
Literature search

4 open access papers mention csi-MIR167e
(5 sentences)

Stem-loop
   -ugcacacaagca   ua    -     aa     a    - -c           u    cgcauuu        aaa   auaaaua 
5'              guc  caag gggaa  aguga gcug c  agcaugaucua cuag       gguuagug   gua       a
                |||  |||| |||||  ||||| |||| |  ||||||||||| ||||       ||||||||   |||       a
3'              cag  guuc uccuu  ucacu cgac g  ucguacuggau gauc       ccaaucau   cau       g
   aacuuaauuuacc   gc    a     cc     c    a uc           c    -------        -ag   gaacgaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr5: 32495360-32495526 [-]
intergenic
Clustered miRNAs
< 10kb from csi-MIR167e
csi-MIR167echr5: 32495360-32495526 [-]
csi-MIR167dchr5: 32492102-32492188 [-]
Database links

Mature sequence csi-miR167e-5p

Accession MIMAT0048886
Sequence

31 - 

ugaagcugccagcaugaucua

 - 51

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR167e-3p

Accession MIMAT0048887
Sequence

115 - 

ggucaugcucugacagccucacu

 - 137

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).