Stem-loop sequence csi-MIR167d

AccessionMI0039635 (change log)
DescriptionCitrus sinensis miR167d stem-loop
Literature search

4 open access papers mention csi-MIR167d
(5 sentences)

Stem-loop
   cag      u           g       ua a  -     ca 
5'    cagcag ugaagcugcca caugauc  a cu uccuu  c
      |||||| ||||||||||| |||||||  | || |||||  u
3'    guuguc acuucgauggu guacuag  u ga aggaa  g
   cua      c           -       gc a  u     cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr5: 32492102-32492188 [-]
intergenic
Clustered miRNAs
< 10kb from csi-MIR167d
csi-MIR167echr5: 32495360-32495526 [-]
csi-MIR167dchr5: 32492102-32492188 [-]
Database links

Mature sequence csi-miR167d-5p

Accession MIMAT0048884
Sequence

11 - 

ugaagcugccagcaugaucua

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR167d-3p

Accession MIMAT0048885
Sequence

56 - 

aucggaucaugugguagcuucacc

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).