Stem-loop sequence csi-MIR166k

AccessionMI0039634 (change log)
DescriptionCitrus sinensis miR166k stem-loop
Literature search

7 open access papers mention csi-MIR166k
(12 sentences)

Stem-loop
   g     -   a    u   a      uu             -    gg   ---a   au 
5'  agagg guu gguu gag ggaaug  gucugguucaaga ucau  agg    aga  a
    ||||| ||| |||| ||| ||||||  ||||||||||||| ||||  |||    |||  a
3'  ucucc caa ccaa cuc ccuuac  cggaccagguucu agua  ucc    ucu  a
   -     u   -    -   a      uu             u    aa   caag   au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
JH999128.1: 426072-426186 [+]
intergenic
Clustered miRNAs
< 10kb from csi-MIR166k
csi-MIR166jJH999128.1: 425836-425968 [+]
csi-MIR166kJH999128.1: 426072-426186 [+]
Database links

Mature sequence csi-miR166k-3p

Accession MIMAT0048883
Sequence

78 - 

ucuuggaccaggcuucauucc

 - 98

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).