Stem-loop sequence csi-MIR166j

AccessionMI0039633 (change log)
DescriptionCitrus sinensis miR166j stem-loop
Literature search

7 open access papers mention csi-MIR166j
(17 sentences)

Stem-loop
   g    -ggag             c g            uucaaaagaaaguuucuuaagaaauaag 
5'  uguu     uugagaggaaugg g cugguucaaagc                            a
    ||||     ||||||||||||| | ||||||||||||                            a
3'  acaa     aacucuccuuacu c gaccagguuucg                            a
   -    auuaa             u g            auagaaaucucucuuucuaaguaugaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
JH999128.1: 425836-425968 [+]
intergenic
Clustered miRNAs
< 10kb from csi-MIR166j
csi-MIR166jJH999128.1: 425836-425968 [+]
csi-MIR166kJH999128.1: 426072-426186 [+]
Database links

Mature sequence csi-miR166j-3p

Accession MIMAT0048882
Sequence

100 - 

uuggaccaggcuucauuccuc

 - 120

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).