Stem-loop sequence csi-MIR166i

AccessionMI0039632 (change log)
DescriptionCitrus sinensis miR166i stem-loop
Literature search

7 open access papers mention csi-MIR166i
(12 sentences)

Stem-loop
   a     ----  a      uu     ac      -uc  gg   aaga   a 
5'  aguug    ag ggaaug  gucug  ucaaga   au  agg    aua a
    |||||    || ||||||  |||||  ||||||   ||  |||    |||  
3'  ucaac    uc ccuuac  cggac  gguucu   ua  ucc    uau u
   -     caaa  a      uu     ca      uau  aa   cgag   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
JH999128.1: 611296-611395 [+]
intergenic
Clustered miRNAs
< 10kb from csi-MIR166i
csi-MIR166hJH999128.1: 611054-611179 [+]
csi-MIR166iJH999128.1: 611296-611395 [+]
Database links

Mature sequence csi-miR166i-3p

Accession MIMAT0048881
Sequence

68 - 

ucuuggaccaggcuucauucc

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).