Stem-loop sequence csi-MIR166h

Accession

MI0039631 (change log)

Description

Citrus sinensis miR166h stem-loop

Literature search

7 open access papers mention csi-MIR166h
(12 sentences)

Stem-loop

   g    ag          u  c   -            -  aaa     -------------        a 
5'  uugg  uugagaggaa gg ggc ugguucaaggcu uc   agaga             guuucuua g
    ||||  |||||||||| || ||| |||||||||||| ||   |||||             |||||||| a
3'  aauu  aacucuccuu cc ucg accagguuucga ag   ucucu             caaagaau a
   -    aa          -  u   g            u  aaa     cucuaauuauuaa        a 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Csi_valencia_1.0; GCA_000317415.1): JH999128.1: 611054-611179 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from csi-MIR166h

• csi-MIR166h: JH999128.1: 611054-611179 [+]
• csi-MIR166i: JH999128.1: 611296-611395 [+]

Database links

• miRBase Tracker:MI0039631

Mature sequence csi-miR166h-3p

• Accession: MIMAT0048880
• Sequence: 95 - uuuggaccaggcuuccuuccuc - 116
• Evidence: experimental; Illumina [1]

References

1. PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).