Stem-loop sequence csi-MIR166h

AccessionMI0039631 (change log)
DescriptionCitrus sinensis miR166h stem-loop
Literature search

7 open access papers mention csi-MIR166h
(12 sentences)

Stem-loop
   g    ag          u  c   -            -  aaa     -------------        a 
5'  uugg  uugagaggaa gg ggc ugguucaaggcu uc   agaga             guuucuua g
    ||||  |||||||||| || ||| |||||||||||| ||   |||||             |||||||| a
3'  aauu  aacucuccuu cc ucg accagguuucga ag   ucucu             caaagaau a
   -    aa          -  u   g            u  aaa     cucuaauuauuaa        a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
JH999128.1: 611054-611179 [+]
intergenic
Clustered miRNAs
< 10kb from csi-MIR166h
csi-MIR166hJH999128.1: 611054-611179 [+]
csi-MIR166iJH999128.1: 611296-611395 [+]
Database links

Mature sequence csi-miR166h-3p

Accession MIMAT0048880
Sequence

95 - 

uuuggaccaggcuuccuuccuc

 - 116

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).