Stem-loop sequence csi-MIR166g

AccessionMI0039630 (change log)
DescriptionCitrus sinensis miR166g stem-loop
Literature search

7 open access papers mention csi-MIR166g
(12 sentences)

Stem-loop
   ---auaucuuucuuucucucaua    a        cu             c      uu   agaa 
5'                        guug ggggaaug  gucugguucgaga cauuca  uga    u
                          |||| ||||||||  ||||||||||||| ||||||  |||    a
3'                        caac ccccuuac  cggaccaggcucu guaagu  acu    g
   uuaacuuaccauuuuguguggaa    c        uu             a      cu   aaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr9: 5710567-5710700 [-]
intergenic
Database links

Mature sequence csi-miR166g-5p

Accession MIMAT0048878
Sequence

29 - 

gaaugcugucugguucgagac

 - 49

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR166g-3p

Accession MIMAT0048879
Sequence

84 - 

ucucggaccaggcuucauucc

 - 104

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).