Stem-loop sequence csi-MIR166f

AccessionMI0039629 (change log)
DescriptionCitrus sinensis miR166f stem-loop
Literature search

7 open access papers mention csi-MIR166f
(12 sentences)

Stem-loop
   --au    g   aaa     --   u           c  uu      cu      auuaauaaua            u 
5'     ggau ggg   aauga  uug uucugagggga ug  gucugg  cgaugc          auuauaauuaua a
       |||| |||   |||||  ||| ||||||||||| ||  ||||||  ||||||          ||||||||||||  
3'     ucua uuu   uuacu  aac aagacuucccu ac  cggacc  gcuaug          uaauauuaauau a
   uuuu    g   --a     ua   u           u  uu      ag      -ggaaaaaag            u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr3: 4882188-4882340 [+]
intergenic
Clustered miRNAs
< 10kb from csi-MIR166f
csi-MIR166fchr3: 4882188-4882340 [+]
csi-MIR166bchr3: 4882349-4882498 [+]
Database links

Mature sequence csi-miR166f-5p

Accession MIMAT0048876
Sequence

31 - 

ggacuguugucuggcucgaug

 - 51

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR166f-3p

Accession MIMAT0048877
Sequence

103 - 

ucggaccaggcuucauucccu

 - 123

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).