Stem-loop sequence csi-MIR166d

AccessionMI0039628 (change log)
DescriptionCitrus sinensis miR166d stem-loop
Literature search

7 open access papers mention csi-MIR166d
(18 sentences)

Stem-loop
   cu  ucuu         c  uu         a   ccaucaauuaauuguaacuuugauucaug 
5'   gu    uugagggga ug  gucugguuc agg                             u
     ||    ||||||||| ||  ||||||||| |||                              
3'   ca    aauuccccu ac  cggaccagg ucu                             g
   gu  --uu         u  uu         c   uguauauacauauaugugugucugugugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
JH999146.1: 206472-206599 [+]
intergenic
Database links

Mature sequence csi-miR166d-5p

Accession MIMAT0048874
Sequence

18 - 

cuguugucugguucaagg

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR166d-3p

Accession MIMAT0048875
Sequence

96 - 

ucucggaccaggcuucauucc

 - 116

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).