Stem-loop sequence csi-MIR166b

AccessionMI0039627 (change log)
DescriptionCitrus sinensis miR166b stem-loop
Literature search

7 open access papers mention csi-MIR166b
(17 sentences)

Stem-loop
   a               uu      cu     g    c     ---uuu     ---u     c   cuuccuaauuu 
5'  ugguugaugggaaug  guuugg  cgagg ucau uaggu      caaaa    uuucu gga           c
    |||||||||||||||  ||||||  ||||| |||| |||||      |||||    ||||| |||           u
3'  gccaacugcccuuac  cggacc  gcucu agug auccg      guuuu    aaagg ccu           u
   a               uu      ag     -    u     uuuauu     uuuu     c   uuuuauuuuca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr3: 4882349-4882498 [+]
intergenic
Clustered miRNAs
< 10kb from csi-MIR166b
csi-MIR166fchr3: 4882188-4882340 [+]
csi-MIR166bchr3: 4882349-4882498 [+]
Database links

Mature sequence csi-miR166b-5p

Accession MIMAT0048872
Sequence

11 - 

ggaauguuguuuggcucgaggg

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR166b-3p

Accession MIMAT0048873
Sequence

120 - 

ucucggaccaggcuucauucc

 - 140

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).