Stem-loop sequence csi-MIR164c

AccessionMI0039626 (change log)
DescriptionCitrus sinensis miR164c stem-loop
Literature search

5 open access papers mention csi-MIR164c
(35 sentences)

Stem-loop
   --auacucauggcau       u   u u           ca    a       uucacaugcguag   a 
5'                ggguggg agc c uguuggagaag  gggc cgugcaa             auc u
                  ||||||| ||| | |||||||||||  |||| |||||||             |||  
3'                cccgcuc uug g acaaccucuuc  cucg gcacguu             uag a
   cuuacucucuuaacu       u   u c           cc    c       ucagaacauucua   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr3: 18768832-18768973 [+]
intergenic
Database links

Mature sequence csi-miR164c-5p

Accession MIMAT0048870
Sequence

31 - 

uggagaagcagggcacgugca

 - 51

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR164c-3p

Accession MIMAT0048871
Sequence

92 - 

cacgcgcuccccuucuccaac

 - 112

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).