Stem-loop sequence csi-MIR164b

AccessionMI0039625 (change log)
DescriptionCitrus sinensis miR164b stem-loop
Literature search

5 open access papers mention csi-MIR164b
(35 sentences)

Stem-loop
   --uauugu  -uauu       u   u  u  c        ca    a        caccacuu    uccu   gg 
5'         uc     gggugag agc cc ug uggagaag  gggc cgugcaaa        uggc    uuc  u
           ||     ||||||| ||| || || ||||||||  |||| ||||||||        ||||    |||  u
3'         ag     uccacuc uug gg ac accucuuc  cucg gcacguuu        accg    aag  u
   cacucucu  uccuu       c   -  u  a        cc    c        ccuaaauc    --uu   ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr5: 34323052-34323202 [-]
intergenic
Clustered miRNAs
< 10kb from csi-MIR164b
csi-MIR164dchr5: 34323478-34323628 [-]
csi-MIR164bchr5: 34323052-34323202 [-]
Database links

Mature sequence csi-miR164b-5p

Accession MIMAT0048868
Sequence

31 - 

uggagaagcagggcacgugca

 - 51

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR164b-3p

Accession MIMAT0048869
Sequence

101 - 

cacgcgcuccccuucuccaac

 - 121

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).