Stem-loop sequence csi-MIR160c

AccessionMI0039624 (change log)
DescriptionCitrus sinensis miR160c stem-loop
Literature search

4 open access papers mention csi-MIR160c
(24 sentences)

Stem-loop
   ugauaua        c       c        u     a   c       a 
5'        uaguaugc uggcucc uguaugcu uuugc aag ccaucag a
          |||||||| ||||||| |||||||| ||||| ||| |||||||  
3'        aucguacg accgagg gcgugcga aggcg uuc ggugguu g
   gauuuaa        u       a        u     g   u       a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr6: 12796053-12796156 [-]
intergenic
Database links

Mature sequence csi-miR160c-5p

Accession MIMAT0048866
Sequence

13 - 

ugccuggcucccuguaugcuu

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR160c-3p

Accession MIMAT0048867
Sequence

74 - 

gcgugcgaggagccaugcaug

 - 94

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).