Stem-loop sequence csi-MIR160b

AccessionMI0039623 (change log)
DescriptionCitrus sinensis miR160b stem-loop
Literature search

4 open access papers mention csi-MIR160b
(24 sentences)

Stem-loop
   guuuc      ---   u   --auu     gu     c       c          a     a  -a      g 
5'      uaaaga   agg gaa     aaugg  uaugc uggcucc uguaugccgc agcag cg  caaucu c
        ||||||   ||| |||     |||||  ||||| ||||||| |||||||||| ||||| ||  |||||| c
3'      auuucu   ucc cuu     uuauc  auacg accgagg gcaugcggug ucguu gc  guuaga g
   cguau      cuu   -   ccuuc     --     a       a          g     -  cg      g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 7769210-7769352 [+]
intergenic
Database links

Mature sequence csi-miR160b-5p

Accession MIMAT0048864
Sequence

31 - 

ugccuggcucccuguaugccg

 - 51

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR160b-3p

Accession MIMAT0048865
Sequence

93 - 

gcguacgaggagccaagcaua

 - 113

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).