Stem-loop sequence csi-MIR159c

AccessionMI0039622 (change log)
DescriptionCitrus sinensis miR159c stem-loop
Literature search

5 open access papers mention csi-MIR159c
(28 sentences)

Stem-loop
   --auua   --        uu          cu      u   aa            a -  g   ac       uc  aa     a  aaagg   ga 
5'       agc  ugggagcu  cuucggucca  uauggg ggc  uaggauuuaauu g cu cug  ucauuca  ca  uacug gu     guc  a
         |||  ||||||||  ||||||||||  |||||| |||  |||||||||||| | || |||  |||||||  ||  ||||| ||     |||   
3'       ucg  acccucga  gaagucaggu  gugucc ucg  auucuaaguuaa c ga ggc  aguaagu  gu  augac ca     uag  a
   aaucgc   uu        gg          uc      u   -a            a a  g   gu       ga  aa     c  -----   gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr5: 1270908-1271096 [+]
intergenic
Database links

Mature sequence csi-miR159c-5p

Accession MIMAT0048862
Sequence

11 - 

gagcuuucuucgguccacuu

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR159c-3p

Accession MIMAT0048863
Sequence

157 - 

cuuggacugaagggagcuccc

 - 177

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).