Stem-loop sequence csi-MIR159b

AccessionMI0039621 (change log)
DescriptionCitrus sinensis miR159b stem-loop
Literature search

5 open access papers mention csi-MIR159b
(28 sentences)

Stem-loop
   -      cu      u    c      uugg    g  g   ac        u  aa        aaa  gg   au 
5'  agucca  caugga gagg aagggu    auua cu ccg  ucauucau ca  cacaguag   ga  agc  u
    ||||||  |||||| |||| ||||||    |||| || |||  |||||||| ||  ||||||||   ||  |||   
3'  ucaggu  gugucu uucu uuccua    uaau ga ggc  aguaagug gu  guguuauc   cu  uug  u
   g      uc      u    -      cuua    a  g   ga        u  aa        ---  -a   gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr1: 9887739-9887888 [-]
intergenic
Database links

Mature sequence csi-miR159b-5p

Accession MIMAT0048861
Sequence

34 - 

agcugccgacucauucauuca

 - 54

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).