Stem-loop sequence csi-MIR156g

AccessionMI0039620 (change log)
DescriptionCitrus sinensis miR156g stem-loop
Literature search

7 open access papers mention csi-MIR156g
(36 sentences)

Stem-loop
   ---------a  u    u     au  uc     ugcugu          -             u  -   a     ug 
5'           ua gggg gaggc  ug  gauga      ugacggaaga uagagagcacaga ga uga augcg  g
             || |||| |||||  ||  |||||      |||||||||| ||||||||||||| || ||| |||||  a
3'           au uccc cuccg  ac  cuacu      acugucuucu aucucucguguuu cu acu uacgu  g
   uauacaauac  u    u     --  uu     ------          u             c  c   c     uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr6: 18413895-18414036 [-]
intergenic
Database links

Mature sequence csi-miR156g-5p

Accession MIMAT0048859
Sequence

31 - 

uugacggaagauagagagcac

 - 51

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR156g-3p

Accession MIMAT0048860
Sequence

92 - 

gcucucuauucuucugucauc

 - 112

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).