Stem-loop sequence csi-MIR156f

AccessionMI0039619 (change log)
DescriptionCitrus sinensis miR156f stem-loop
Literature search

7 open access papers mention csi-MIR156f
(36 sentences)

Stem-loop
   -gguaacuugcuua  -u     cu gg           a   -           -a    c  uu   u      
5'               ac  augaa  u  uucgaugacag aga gagagaguaca  cccg ca  agc aaaga 
                 ||  |||||  |  ||||||||||| ||| |||||||||||  |||| ||  ||| |||| g
3'               ug  uauuu  a  gaguuacuguc ucu cucucucgugu  gggu gu  ucg uuucu 
   guuuauuaauuuac  uu     uu uu           c   u           ga    u  uu   -      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr4: 5738174-5738319 [-]
intergenic
Database links

Mature sequence csi-miR156f-5p

Accession MIMAT0048857
Sequence

31 - 

augacagaagagagagaguac

 - 51

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR156f-3p

Accession MIMAT0048858
Sequence

95 - 

gcucucucuucuccugucauug

 - 116

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).