Stem-loop sequence csi-MIR156e

AccessionMI0039618 (change log)
DescriptionCitrus sinensis miR156e stem-loop
Literature search

7 open access papers mention csi-MIR156e
(36 sentences)

Stem-loop
   -----    uc  a       aa     gaug             -              u  -        --u  a 
5'      agug  ag ggaggga  ugggu    cuggugacagaag auagagagcgcaga ga ugauaugc   cu a
        ||||  || |||||||  |||||    ||||||||||||| |||||||||||||| || ||||||||   || u
3'      ucac  uc ccucccu  acuua    gacuacugucuuc ugucucucguguuu cu acuauaug   ga g
   uucuu    --  c       -g     accg             g              c  c        uuu  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr7: 24974743-24974889 [-]
intergenic
Database links

Mature sequence csi-miR156e-5p

Accession MIMAT0048855
Sequence

31 - 

gugacagaagauagagagcgc

 - 51

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR156e-3p

Accession MIMAT0048856
Sequence

96 - 

gcucucugugcuucugucauca

 - 117

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).