Stem-loop sequence csi-MIR156d

AccessionMI0039617 (change log)
DescriptionCitrus sinensis miR156d stem-loop
Literature search

7 open access papers mention csi-MIR156d
(36 sentences)

Stem-loop
   gaaauu   u        g            -uaaa         cauua 
5'       uug ugacagaa auagagagcgca     uuaaaaugc     a
         ||| |||||||| ||||||||||||     |||||||||      
3'       aac acugucuu ugucucucgugu     aauuuuacg     g
   acgugc   u        a            uucua         caaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 10012779-10012879 [+]
intergenic
Database links

Mature sequence csi-miR156d-5p

Accession MIMAT0048854
Sequence

11 - 

ugacagaagauagagagcgc

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).