Stem-loop sequence csi-MIR156c

AccessionMI0039616 (change log)
DescriptionCitrus sinensis miR156c stem-loop
Literature search

7 open access papers mention csi-MIR156c
(37 sentences)

Stem-loop
   ------uuaauuaauuguaaaaa    aaga  a         -             a   gguauuuucuugcaugcu 
5'                        gggu    gg ggugacaga agagagugagcac cau                  u
                          ||||    || ||||||||| ||||||||||||| |||                   
3'                        ccca    cc ccacugucu ucucucacucgug gua                  u
   ucccucuaaaaaccccccgcccc    ---a  -         a             c   gcgaaguucguccuagag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr4: 3430774-3430922 [-]
intergenic
Database links

Mature sequence csi-miR156c-5p

Accession MIMAT0048852
Sequence

31 - 

ugacagaagagagugagcac

 - 50

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR156c-3p

Accession MIMAT0048853
Sequence

99 - 

gcucacucucuaucugucacc

 - 119

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).