Stem-loop sequence csi-MIR156b

AccessionMI0039615 (change log)
DescriptionCitrus sinensis miR156b stem-loop
Literature search

7 open access papers mention csi-MIR156b
(36 sentences)

Stem-loop
   ---uuc   -u  ua     u  a  auu   a         -   -         a        -gu      a 
5'       uca  uc  auucu gg ac   gaa uugacagaa gag agugagcac cagaggca   uguaua u
         |||  ||  ||||| || ||   ||| ||||||||| ||| ||||||||| ||||||||   ||||||  
3'       ggu  ag  uaagg cc ug   cuu gacugucuu cuc ucacucgug guuuucgu   acauau u
   ucuccc   uc  uc     -  a  -ac   c         u   g         c        ugu      g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr7: 3637037-3637179 [+]
intergenic
Database links

Mature sequence csi-miR156b-5p

Accession MIMAT0048850
Sequence

31 - 

ugacagaagagagugagcac

 - 50

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR156b-3p

Accession MIMAT0048851
Sequence

92 - 

gcucacugcucuuucugucagcu

 - 114

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).